public class ConvertRampSeqTagsToMapPlugin
extends net.maizegenetics.plugindef.AbstractPlugin
This plugin expects 2 input files as plugin parameters and a HaplotypeGraph object passed in as an input DataSet.
It will output a Multimap
First file, hapIdMappingFile is a tab separated text file having the following format:
Tag Node ChiSq
L9.6366CA9D 12066644 55.9832
L9.95C33216 11966694 155.464
L9.2A55A52D 12278394 125.181
L9.99A622E8 11952178 421.905
L9.441428C4 12196601 169.546
There can be additional columns, but the first three need to be this way. It also helps if you prefilter the text file to only contain one Tag->Node mapping for each tag.
In the test case we pick the best Node with the highest ChiSq for each tag to speed up processing
The Second file is a presence/absence matrix for each taxa we want to push through the pipeline. Also is tab separated text file in the form:
TagID Tag A188 A239
L9.FE0EFC71 ACATCGAGCTTGGCCTGCATCTCGCGGATTTGCTCGAGCTGTGTGTCCTGACCCCCCGCAGGGACTGGGACCACAGCTAGCTCCAGCAGGATGTCAACGCGAGGCGCAGGCCCAAGGGGATCGTCATCCTC 0 0
L9.5DCFAAB9 ACGTCGAGCCTGGCCTACATCTCGCGGATTTGCTCGAGCTGTGCGTCCTGACCCCCCGTAGGGACTAGGAACATAGCTAGCTCCCGAAGGATGTCAACGCGAGGCACATGCCTAGGGGGATCACCGTCCTC 0 1
L9.188D3BB2 ACGTCGAGCCTGGCCTGTACCTCGCGAATTTGCTCGAGCTGTGCGTCCTGACCCCCCGCAGGGACTGGGACCACAGCTAGCTCCCGAAGGATGTCAACGCGAGGCGCAGGCCTAGGGGGATCACCGTCCTC 0 0
Where 1 means that taxa had a hit for that tag. This file can have as many columns as needed, but the first two are expected to be TagID and the Tag sequence.
The plugin will go through and add entries into the Multimap for each taxon->HapNode pair(Exactly the same as what is returned from HapCountBestPathToVCFPlugin).
This Multimap is then used by the PathsToVCFPlugin to output a vcf file.
| Constructor and Description |
|---|
ConvertRampSeqTagsToMapPlugin(Frame parentFrame,
boolean isInteractive) |
| Modifier and Type | Method and Description |
|---|---|
String |
getButtonName() |
ImageIcon |
getIcon() |
String |
getToolTipText() |
String |
pluginDescription() |
String |
pluginUserManualURL() |
net.maizegenetics.plugindef.DataSet |
processData(net.maizegenetics.plugindef.DataSet input)
Plugin method to process the data
|
String |
tagCountsByTaxaFile()
File holding the tag counts for each taxa
|
ConvertRampSeqTagsToMapPlugin |
tagCountsByTaxaFile(String value)
Set Tag Count By Taxa File.
|
String |
tagToHapIdMapFile()
tagToHapIDMappingFile
|
ConvertRampSeqTagsToMapPlugin |
tagToHapIdMapFile(String value)
Set Hap Id Mapping File.
|
addListener, cancel, convert, dataSetReturned, getCitation, getInputs, getMenu, getPanel, getParameter, getParameter, getParentFrame, getUsage, getUsageHTML, isInteractive, performFunction, progress, progress, receiveInput, reverseTrace, run, setConfigParameters, setParameter, setParameter, setParameter, setParameters, setParametersToDefault, setThreaded, trace, wasCancelledpublic ConvertRampSeqTagsToMapPlugin(Frame parentFrame, boolean isInteractive)
public net.maizegenetics.plugindef.DataSet processData(net.maizegenetics.plugindef.DataSet input)
processData in interface net.maizegenetics.plugindef.PluginprocessData in class net.maizegenetics.plugindef.AbstractPlugininput - A DataSet Object where a HaplotypeGraph is the first element in the data structurepublic ImageIcon getIcon()
public String getButtonName()
public String getToolTipText()
public String pluginDescription()
pluginDescription in interface net.maizegenetics.plugindef.PluginpluginDescription in class net.maizegenetics.plugindef.AbstractPluginpublic String pluginUserManualURL()
pluginUserManualURL in interface net.maizegenetics.plugindef.PluginpluginUserManualURL in class net.maizegenetics.plugindef.AbstractPluginpublic String tagToHapIdMapFile()
public ConvertRampSeqTagsToMapPlugin tagToHapIdMapFile(String value)
value - Hap Id Mapping Filepublic String tagCountsByTaxaFile()
public ConvertRampSeqTagsToMapPlugin tagCountsByTaxaFile(String value)
value - Tag Count By Taxa FileCopyright © 2018. All rights reserved.