Plasmids
For cloning of an APOBEC3G promoter-driven reporter plasmid, genomic DNA was prepared from the T cell line PM1 using the DNeasy Kit (Qiagen). The DNA sequence ranging from positions -959 to +66 relative to the identified transcription start was amplified via PCR using the primers 3Gprom1025 (5'-TGTGAACGCGTTGCTGCAGGCCATCTGGATGTATATG-3') and 3Gpromreverse (5'-ACAGCAGATCTAGGGACCTCTGATAAAGACAGG-3'). PCR reactions were performed with Pwo DNA Polymerase (Roche) using the following cycle conditions: one cycle 94degreesC for 2 min; 30 cycles 94degreesC for 30 s, 58degreesC for 60 s, 72degreesC for 60 s; one cycle 72degreesC for 7 min. The amplicon was ligated into the promoterless luciferase reporter plasmid pGL3-Basic (Promega) via MluI and BglII restriction sites, which were introduced by the primers. The resulting construct contained 1025 bp of the A3G promoter and was designated pGL3-APOprom1025. Reporter plasmids containing shorter fragments of the APOBEC3G promoter were constructed using pGL3-APOprom1025 as template and the following forward primers: for plasmid pGL3-APOprom502 (containing sequence -436/+66): 3Gprom502 (5'-TGTGAACGCGTTCCATAACATGGGGACAAGA-3'); for plasmid pGL3-APOprom225 (containing sequence -159/+66): 3Gprom225 (5'-TGTGAACGCGTCGAGGGCAGGATCCGGGAGT-3'); for plasmid pGL3-APOprom180 (containing sequence -114/+66): 3Gprom180 (5'-TGTGAACGCGTTCTTGATGGTGGAGAGGAGG-3'); for plasmid pGL3-APOprom150 (containing sequence -84/+66): 3Gprom150 (5'-TGTGAACGCGTGCGGGACCACCAGGGGAGGGGCTT-3'); for plasmid pGL3-APOprom120 (containing sequence -54/+66): 3Gprom120 (5'-TGTGAACGCGTTGCTGGCTCAGCCTGGTGTG-3'); for plasmid pGL3-APOprom60 (containing sequence +7/+66): 3Gprom60 (5'-TGTGAACGCGTCCCTTTGCAATTGCCTTG-3'); each in combination with the reverse primer 3Gpromreverse (described above). PCR reactions were performed with Pfu Ultra Hotstart (Stratagene) using the following cycle conditions: one cycle 94degreesC for 2 min; 30 cycles 94degreesC for 45 s, 58degreesC for 45 s, 72degreesC for 60 s; one cycle 72degreesC for 7 min. As for pGL3-APOprom1025, MluI and BglII restriction sites were introduced via the primers and PCR products were ligated into pGL3-Basic (Promega) via these restriction sites. pGL3-APOprom180mut carries two point mutations (bold) and was generated using the primer 3GProm180mut (5'-TGTGAACGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGTTCGGGACCACCAG-3') in combination with primer 3Gpromreverse. This PCR was performed with an annealing temperature of 65degreesC. pGL3promE1 (containing nucleotides -114/-85) and pGL3promE2 (containing nucleotides -92/-63) were constructed by annealing the following single-stranded oligonucleotides: 114_85Plus (5'- CGCGTTCTTGATGGTGGAGAGGAGGCTCCAGCTGGA-3') and 114_85Minus (5'- GATCTCCAGCTGGAGCCTCCTCTCCACCATCAAGAA-3') or 92-63Plus (5'-CGCGTCCAGCTGGGCGGGACCACCAGGGGAGGGGCA-3') and 92_63Minus (5'-GATCTGCCCCTCCCCTGGTGGTCCCGCCCAGCTGGA-3'). After annealing, the double-stranded oligonucleotides which contained the respective 30 bp of the APOBEC3G promoter and sticky ends compatible with MluI and BglII restriction sites were ligated into the pGL3-Promoter (Promega) vector. The sequences of all constructed plasmids were verified by sequence analysis. Nucleotide -219 of the cloned APOBEC3G promoter differs from the sequence in the database (GenBanktrade accession number DQ147772). An A-to-C substitution is present at this position. Numbering is relative to the major transcriptional start site we identified. 
The reporter plasmids pGL3-Control and phRG-TK were purchased from Promega. pGL2-CVX contains two repeats of the IFN-responsive GAS (gamma activated sequence) elements (GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG) of the guanylate-binding protein (GBP) gene in front of a CMV minimal promoter and was kindly provided by Ute Pagelow and Mario Koster from the Helmholtz-Zentrum fur Infektionsforschung. Plasmid pNL4-3 (NIBSC, UK) contains the full-length HIV-1NL4-3 genome and has been described previously (34). pcDNA3.1Vif was generously provided by Nathaniel R. Landau from the Salk Institute, La Jolla. It was generated by amplifying the Vif gene from pNL4-3 and ligating it into the pcDNA3.1 vector via BamHI and XhoI restriction sites. A 3'-WPRE element was included into the XhoI site. pBS-kRSPA-TatHIV-1(NL4-3) was constructed by amplifying the two exons of Tat via PCR reaction using the molecular clone pNL4-3 as template and the following primer sets: exon1, 5UXho1HIV-Tat 1Plus (5'-GCATGCTCGAGATGGAGCCAGTAGATCCTAG-3') and HIV-Tat 1Minus (5'-TGCTTTGATAGAGAAGCTTGATG-3'); exon2, 15FHIV-Tat2Plus (5'-TTCTCTATCAAAGCAACCCACCTCCCAATCCCG-3') and 5USpe1HIV-Tat2Minus (5'-GACGTACTAGTCTATTCCTTCGGGCCTGTC-3'). XhoI and SpeI restriction sites were introduced via the primers. The sense-primer of exon2 starts with a 15-mer which is homologous to the 3' end of exon1 and necessary for fusion of both exons. PCRs were performed with Expand High Fidelity PCR System (Roche) using the following conditions: one cycle 94degreesC for 3 min; 35 cycles 94degreesC for 45 s, 55degreesC for 45 s, 68degreesC for 45 s; one cycle 68degreesC for 7 min. For fusion of both exons, the following PCR conditions were applied: one cycle 94degreesC for 3 min; 35 cycles 94degreesC for 45 s, 58degreesC for 45 s, 68degreesC for 60 s. After 10 cycles without primers, the sense-primer of exon1 and the antisense-primer of exon2 were added for the remaining cycles. The resulting amplicon was ligated into the pBS-kRSPA vector (35) via XhoI and SpeI restriction sites. 
