Plasmid construction.
The epsilony promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the epsilony proximal promoter. A 2.2-kb fragment upstream of the epsilony globin initiation codon (ATG) was used, because it has been shown that all sequences required for epsilon gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the epsilon globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the epsilony promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of muLCRbeta 9.3 (micro LCR; [31]) was then inserted upstream of the epsilony promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the epsilony promoter. A series of deletion constructs of the epsilony promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5'CCGCTCGAGTGCTAGGCAAACACTCA3' (-2077 to -2052); MHB1503, 5'CCGCTCGAGTCTCTACACTGTCACTCCCTG3' (-634 to -605); MHB1505, 5'CCGCTCGAGGGAGCCAAAAAAAGAATGC3' (-197 to -169); MHB1506, 5'CCGCTCGAGCTGACCAATGGCTTCAAAG3' (-85 to -58); MHB1532, 5'CCGCTCGAGAATGCAGAACAAAGGGTCAGA3' (-63 to -34); and MHB1507, 5'CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3' (-37 to -9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5'CGGAAGCTTGGGAGGTTGCTGGTGA3' (+45 to +20). 
Sox6-pcDNA3.1 [15] was used to overexpress Sox6. A truncated version of the Sox6 overexpression construct (Sox6-DeltaHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. Mutagenesis of Sox/Sox6 consensus binding sites of the epsilony promoter were done by PCR. Forward primers used to generate these mutagenized epsilony promoter reporter constructs include: MHB1661, 5'CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3' (-63 to -19); MHB1662, 5'CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3' (-63 to -16); and MHB1663, 5'CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3' (-63 to -18). 
