Quantitation of globin mRNA.
RNA was first reverse transcribed to cDNA. Primers for cDNA PCR amplification of globin genes were obtained from Primerbank [51]. All primers were searched against the NCBI database to confirm specificity. For epsilony globin: MHB1666, 5'TGGCCTGTGGAGTAAGGTCAA3'; and MHB1667, 5'GAAGCAGAGGACAAGTTCCCA3'. For zeta globin: MHB1668, 5'CTACCCCCAGACGAAGACCTA3'; and MHB1669, 5'CTTAACCGCATCCCCTACGG3'. For betaH1 globin: MHB1672, 5'TGGACAACCTCAAGGAGACC3'; and MHB1673, 5'ACCTCTGGGGTGAATTCCTT3'. For betamaj/min globin: MHB1674: 5'ATGGCCTGAATCACTTGGAC3'; and MHB1675, 5'ACGATCATATTGCCCAGGAG3'. Using the SYBR green supermix kit with ROX (Bio-Rad, Hercules, California, United States), PCR amplification was run on an ABI7000 (Applied Biosystems, Foster City, California, United States) at the University of Arizona core facility. All PCR was performed in a 25-mul reaction with 12.5 mul SYBR green supermix. GAPDH mRNA levels were used as control for input RNA. Standard curve analyses were performed to test the efficiency of the amplifications. Triplicates were done for each PCR reaction. Relative quantitative values were calculated in the ABI Prism 7000 SDS Software (Applied Biosystems) and normalized to GAPDH in Microsoft Excel (Redmond, Washington, United States). 
