ChIP assay.
As described by Nouzova [53], in brief: Cells from MEL cells (4 x 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 degreesC, rinsed in ice-cold 1x Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 degreesC, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 degreesC for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the epsilony promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides -31 to +140 of the epsilony promoter (primers MHB1688, 5'CGAAGAATAAAAGGCCACCA3'; and MHB1689, 5'GCTTCACCACCAACCTCTTC3'). PCR was performed under the following conditions: 95 degreesC for 15 min followed by 30 cycles at 95 degreesC for 30 s, 60 degreesC for 30 s, and 72 degreesC for 45 s, ending with a final extension at 72 degreesC for 5 min. 
